Y47G6A.31

Y47G6A.31 |

No description available.

Graphics for Y47G6A.31

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for Y47G6A.31

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 23141 - Tier: 1 - Name: Y47G6A.31 - Cosmid: Y47G6A.31 - WBGeneID: WBGene00044436 - Length: 115 - PAS: AATAAA
Cluster Coverage (%): 195 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
23141	Y47G6A.31	I	+	3604427	3604541	115nt	AATAAA (-18nt)	195 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|115nt|I:3604427..3604541|PAS:AATAAA
uuuuguguuucuagacgaugaaauacgggucacaaagauguucgguggaaugauuguaugcuauuuuucauguaccuuuu
cacgauuuuucucaaaaauaaauuuauuuuuaua

Updated miRanda Targets for Y47G6A.31 (Murari et al., submitted)

Y47G6A.31 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
11637	cel-miR-54-3p	Y47G6A.31	156	-17.91	78.95	78.95
57854	cel-miR-360-5p	Y47G6A.31	153	-18.23	68.75	81.25
12512	cel-miR-56-3p	Y47G6A.31	152	-15.02	63.16	73.68
68359	cel-miR-795-3p	Y47G6A.31	151	-14.34	75.00	81.25
90	cel-let-7-5p	Y47G6A.31	149	-18.35	56.25	87.50
143782	cel-miR-8203-5p	Y47G6A.31	149	-13.61	68.75	75.00
11096	cel-miR-53-5p	Y47G6A.31	148	-15.01	66.67	77.78
152431	cel-miR-12134	Y47G6A.31	148	-13.00	68.42	78.95
10777	cel-miR-52-5p	Y47G6A.31	147	-15.01	72.22	77.78
10041	cel-miR-51-5p	Y47G6A.31	146	-13.40	76.92	76.92
12177	cel-miR-55-3p	Y47G6A.31	145	-15.97	100.00	100.00