Y47G6A.32

Y47G6A.32 |

No description available.

Graphics for Y47G6A.32

3'UTR Zoom

Locus

Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for Y47G6A.32

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 23142 - Tier: 1 - Name: Y47G6A.32 - Cosmid: Y47G6A.32 - WBGeneID: WBGene00044437 - Length: 483 - PAS: AATAAA
Cluster Coverage (%): 366 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id	Name	Chr	Strand	Start	End	Length	PAS	Coverage
23142	Y47G6A.32	I	+	3625087	3625569	483nt	AATAAA (-21nt)	366 reads

This 3'UTR isoform has been detected in the following tissues:

UTRome v3¹	Intestine²	Pharynx²	Body Muscle²	Arcade cells²	GABA neurons²	NMDA neurons²	Hypodermis²	Seam cells²

¹Murari et al., 2023
²Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)

>|3'UTR|483nt|I:3625087..3625569|PAS:AATAAA
uuuuagauaguuuuuuuuuguugaugagaaguuagcugugugagauuuggaaauuuauggcaaauuuauaagggaaaacu
gaaaauuauuccuuaaaaacuuccacuauuuuggaaaacauuuggguccaacucaaguaaaauguuuuuuuugcaaauuc
uggaaguuguuaggcuucagugaauaacaaccucggucucaaugcaucacauuugacgcgcaagcucaacauuuaaaauu
ugcccaaauuugccauaacuucucacuucucaccugcauuuguauacaccauaacugaugcgcaagccccucuaauuaua
uauuuccggugcucaaaagcucauaauugucuguaaauagucuccauauguuucugaacaugcggguaacuuguucuauu
guauauuuccuuuuccacuuaccucaucucuugccauuucaauuuugaacuacgcaccuuuaauaaaacauuuuuaaaac
ua

Updated miRanda Targets for Y47G6A.32 (Murari et al., submitted)

Y47G6A.32 transcript has been predicted to be targeted by the following miRNAs:

ID	miRNA	Target Gene	Score	Energy	% Binding (Target)	% Binding (miRNA)
106325	cel-miR-4920	Y47G6A.32	163	-7.52	77.78	77.78
75614	cel-miR-1021	Y47G6A.32	158	-15.21	75.00	75.00
19167	cel-miR-73-3p	Y47G6A.32	154	-18.18	68.42	78.95
19555	cel-miR-74-3p	Y47G6A.32	153	-16.96	83.33	91.67
135358	cel-miR-8187-3p	Y47G6A.32	153	-15.29	72.22	77.78
105053	cel-miR-4814-3p	Y47G6A.32	153	-21.56	71.43	71.43
40671	cel-miR-246-5p	Y47G6A.32	152	-12.79	66.67	86.67
18775	cel-miR-72-5p	Y47G6A.32	151	-14.12	65.00	75.00
135655	cel-miR-8188-5p	Y47G6A.32	151	-15.29	75.00	81.25
51202	cel-miR-259-5p	Y47G6A.32	149	-14.13	66.67	75.00
63641	cel-miR-788-3p	Y47G6A.32	148	-15.50	71.43	76.19
51869	cel-miR-261	Y47G6A.32	148	-10.12	81.82	90.91
91264	cel-miR-2209b-3p	Y47G6A.32	147	-18.92	75.00	75.00
71969	cel-miR-800-5p	Y47G6A.32	146	-12.43	73.33	80.00
52638	cel-miR-266	Y47G6A.32	146	-13.73	64.71	70.59
34515	cel-miR-232-3p	Y47G6A.32	143	-11.99	61.90	66.67
133558	cel-miR-356b-5p	Y47G6A.32	142	-13.77	70.59	76.47
146125	cel-miR-8206-5p	Y47G6A.32	141	-4.90	90.00	90.00
105395	cel-miR-4816-5p	Y47G6A.32	140	-12.71	100.00	100.00
67068	cel-miR-794-5p	Y47G6A.32	140	-10.26	100.00	100.00
39715	cel-miR-242	Y47G6A.32	140	-11.52	100.00	100.00