UTRome

inx-13

Y8G1A.2 | INneXin 13

inx-13 encodes an innexin, an integral transmembrane channel protein that is a structural component of invertebrate gap junctions; INX-13 is essential for larval development and osmoregulation, and may be a component of the gap junctions that link the excretory and hypodermal cells; INX-13 is expressed embryonically in hypodermis and post-embryonically, in hypodermal seam cells, the excretory cell, and the developing vulva and spermatheca; in hypodermal cells, INX-13 localizes to the plasma membrane at points of contact between adjacent cells.

Graphics for inx-13

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.


Operon Information

This gene is part of the operon CEOP1108 (I:3759075..3748537)
CEOP1108 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for inx-13

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 2087 - Tier: 1 - Name: inx-13 - Cosmid: Y8G1A.2 - WBGeneID: WBGene00002135 - Length: 229 - PAS: AATAAA
Cluster Coverage (%): 3864 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
2087 inx-13 I - 3748523 3748750 229nt AATAAA (-23nt) 3864 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|229nt|I:3748523..3748750|PAS:AATAAA
augaagagauuaugaaggauuaugaauuuuuauaucaauugucuucaaauucacgugucuagugccuuccccucaccaca
acauucguuagacauccuguugcgcucccuuugcacuuuccaaauuguucuuuuuuucuagccaagaauuguuuguucuu
uuuucacuuucauguuauucacaaucuaauaauuaucgacagaguaauaaacgguguuuuaugccuga


Updated miRanda Targets for inx-13 (Murari et al., submitted)

inx-13 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
125094 cel-miR-5549-5p inx-13 163 -15.97 82.35 88.24
84133 cel-miR-2207-5p inx-13 160 -16.25 68.18 77.27
31556 cel-miR-124-3p inx-13 151 -17.44 70.00 80.00
29004 cel-miR-86-5p inx-13 140 -9.59 100.00 100.00
60663 cel-miR-785-3p inx-13 140 -6.55 100.00 100.00
71515 cel-miR-800-5p inx-13 140 -7.05 100.00 100.00
102188 cel-miR-4811-5p inx-13 140 -8.58 100.00 100.00
113862 cel-miR-5546-3p inx-13 140 -4.00 100.00 100.00



Predicted or Experimental Interactors for inx-13 (WormBase)

inx-13 has been predicted to interact with the following genes (data from WS200):

  • aco-1 Lee I et al. (2008)
    aco-1 encodes an aconitase that is homologous to mammalian iron regulatory protein-1 (IRP1); aco-1 activity is required for normal brood sizes and, under iron stress conditions, for normal lifespan and L4-to-adult growth rates; ACO-1 physically interacts with GEX-3; like IRP1, ACO-1 has aconitase activity and is post-translationally regulated by iron, but, unlike IRP1, it lacks RNA-binding activity; ACO-1 is predicted to be mitochondrial, and its mRNA levels appear to decrease in response to iron treatment.
  • haf-9 Lee I et al. (2008)
    haf-9 is orthologous to the human gene ATP-BINDING CASSETTE, SUB-FAMILY B (MDR/TAP), MEMBER 3 (TAP2; OMIM:170261), which when mutated leads to disease.
  • inx-12 Lee I et al. (2008)
    inx-12 (innexin=invertebrate connexin analogue) encodes a protein of the innexin family; innexins are gap junction proteins similar in function, though dissimilar in sequence to the vertebrate connexins; innexins are the only known gap junction proteins in invertebrates; inx-12 and inx-13 appear to be a tandom duplication; RNA interference of inx-12 results in an arrest at the L1 larval stage with fluid filled dead rods; this phenotype and sequence homology to Drosophila innexins suggest that INX-12 may be required to form gap junctions between the excretory canal and hypodermis, thus playing an essential role in osmoregulation; an INX-12::GFP fusion protein is expressed in the excretory canal.


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001