asic-1
ZK770.1 | Acid-sensing/Amiloride-Sensitive Ion Channel family 1
No description available.
Graphics for asic-1
3'UTR Zoom
Locus
see this gene in GBrowse
3'UTR mapped for asic-1
If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.1
ID: 22503 -
Tier: 1 -
Name: asic-1 -
Cosmid: ZK770.1 -
WBGeneID: WBGene00022815 -
Length: 38 -
PAS: cgtaaa
Cluster Coverage (%): 191 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)
id | Name | Chr | Strand | Start | End | Length | PAS | Coverage |
---|---|---|---|---|---|---|---|---|
22503 | asic-1 | I | + | 3773876 | 3773913 | 38nt | cgtaaa (-20nt) | 191 reads |
This 3'UTR isoform has been detected in the following tissues:
UTRome v31 | Intestine2 | Pharynx2 | Body Muscle2 | Arcade cells2 | GABA neurons2 | NMDA neurons2 | Hypodermis2 | Seam cells2 |
---|---|---|---|---|---|---|---|---|
![]() |
  |
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|38nt|I:3773876..3773913|PAS:cgtaaa
ucucuuuuucuucggcucguaaaacuuuuuucuauga
Updated miRanda Targets for asic-1 (Murari et al., submitted)
asic-1 transcript has been predicted to be targeted by the following miRNAs:ID | miRNA | Target Gene | Score | Energy | % Binding (Target) | % Binding (miRNA) |
---|---|---|---|---|---|---|
108366 | cel-miR-4923a | asic-1 | 140 | -7.52 | 100.00 | 100.00 |
More on asic-1
Related Papers

The APAome Project is currently funded by the School of Life Sciences at Arizona State University