UTRome

F47B3.3

F47B3.3 |

No description available.

Graphics for F47B3.3

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.

3'UTR mapped for F47B3.3

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 17858 - Tier: 1 - Name: F47B3.3 - Cosmid: F47B3.3 - WBGeneID: WBGene00018527 - Length: 66 - PAS: AATAAA
Cluster Coverage (%): 686 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
17858 F47B3.3 I + 3965314 3965379 66nt AATAAA (-18nt) 686 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
>|3'UTR|66nt|I:3965314..3965379|PAS:AATAAA
auuuuccacucuuuuguauugcaacacauuccauccguuuuuugaacaauaaauauaauuuugga


Updated miRanda Targets for F47B3.3 (Murari et al., submitted)

F47B3.3 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
68771 cel-miR-796 F47B3.3 155 -16.95 75.00 87.50
1541 cel-miR-1-3p F47B3.3 151 -13.34 61.11 77.78
90577 cel-miR-2217a-5p F47B3.3 149 -15.89 75.00 91.67
151550 cel-miR-2217b-5p F47B3.3 149 -12.55 75.00 91.67
101034 cel-miR-4809-3p F47B3.3 140 -11.99 100.00 100.00




 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001