ftn-2

3'UTR mapped for ftn-2

1 ID: 1411 - Tier: 1 - Name: ftn-2 - Cosmid: D1037.3 - WBGeneID: WBGene00001501 - Length: 112 - PAS: aatgaa
Cluster Coverage (%): 29014 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

UTRome v31	Intestine2	Pharynx2	Body Muscle2	Arcade cells2	GABA neurons2	NMDA neurons2	Hypodermis2	Seam cells2

>|3'UTR|112nt|I:3680180..3680290|PAS:aatgaa
uuaauauauaucuuaucugcucaucgcaucuucuuuuguucucucuguacauaauuauuugcgaaaauuuacaaacaugc
cacaaucugucaaaugaaaaguauugaucga

Updated miRanda Targets for ftn-2 (Murari et al., submitted)

Predicted or Experimental Interactors for ftn-2 (WormBase)

• aco-1 Lee I et al. (2008)
  aco-1 encodes an aconitase that is homologous to mammalian iron regulatory protein-1 (IRP1); aco-1 activity is required for normal brood sizes and, under iron stress conditions, for normal lifespan and L4-to-adult growth rates; ACO-1 physically interacts with GEX-3; like IRP1, ACO-1 has aconitase activity and is post-translationally regulated by iron, but, unlike IRP1, it lacks RNA-binding activity; ACO-1 is predicted to be mitochondrial, and its mRNA levels appear to decrease in response to iron treatment.
• aps-3 Lee I et al. (2008)
  aps-3 encodes an adaptin orthologous to the sigma3 subunit of the heterotetrameric adaptor protein complex 3 (AP-3); by homology, APS-3 is predicted to play a role in intracellular membrane trafficking and specifically, may be involved in transport of lysosomal membrane proteins from tubular sorting endosomes to lysosomes; loss of aps-3 activity via large-scale RNAi screens in the sensitized rrf-3 background indicates that, in C. elegans, APS-3 is required for fertility and reproduction.
• cutc-1 Lee I et al. (2008)
  none available
• gst-33 Zhong W et al. (2006)
  none available
• ima-3 Lee I et al. (2008)
  ima-3 encodes one of three C. elegans importin alpha nuclear transport factors and the importin alpha that is most similar to the alpha3-subtype; ima-3 activity is required throughout development: during oogenesis, ima-3 is essential for progression past pachytene of meiotic prophase I and for proper organization of the nuclear pore complex (NPC) as well as association of P granules with the NPC; ima-3 is also required for normal embryonic, larval, and germline development; in vitro, IMA-3 can interact with human importin beta1, suggesting that it functions in a complex with C. elegans importin betas in vivo; IMA-3 is expressed in males and hermaphrodites, in both the germline and in somatic tissue; in the germline, IMA-3 is seen in the common cytoplasm of the rachis and in association with the nuclear envelope of germline nuclei and the residual body of developing spermatids.
• ima-3 Zhong W et al. (2006)
  ima-3 encodes one of three C. elegans importin alpha nuclear transport factors and the importin alpha that is most similar to the alpha3-subtype; ima-3 activity is required throughout development: during oogenesis, ima-3 is essential for progression past pachytene of meiotic prophase I and for proper organization of the nuclear pore complex (NPC) as well as association of P granules with the NPC; ima-3 is also required for normal embryonic, larval, and germline development; in vitro, IMA-3 can interact with human importin beta1, suggesting that it functions in a complex with C. elegans importin betas in vivo; IMA-3 is expressed in males and hermaphrodites, in both the germline and in somatic tissue; in the germline, IMA-3 is seen in the common cytoplasm of the rachis and in association with the nuclear envelope of germline nuclei and the residual body of developing spermatids.
• lit-1 Zhong W et al. (2006)
  lit-1 encodes a serine threonine protein kinase homolog related to the Drosophila protein Nemo that is required for embryonic viability, plays a central role in controlling the asymmetry of cell divisions during embryogenesis, and affects EMS, MS, and C lineages; acts downstream of mom-2 with respect to polarity defects and mediates larval cell fate decisions that involve POP-1, and is expressed in most embryonic and larval cells.
• mis-12 Lee I et al. (2008)
  mis-12 encodes the C. elegans homolog of human and Schizosaccharomyces pombe Mis12 protein; mis-12 activity is required for proper attachment of chromosomes to the mitotic spindle and thus, for embryonic development; MIS-12 localizes to the kinetochore throughout mitosis, and this localization requires the activity of KNL-3, a novel kinetochore component with which MIS-12 co-purifies as part of a large complex of interacting kinetochore proteins.
• nhr-51 Zhong W et al. (2006)
  none available
• nmr-2 Lee I et al. (2008)
  nmr-2 encodes an ionotropic glutamate receptor (iGluR) subunit that is most similar to members of the NR2A subfamily of the NMDA class of iGluRs; genetic analysis indicates that nmr-2 is required for full memory retention of a learned avoidance behavior, namely avoidance of NaCl after starvation conditioning; in addition, NMR-2 activity is required for NMDA-gated currents in the AVA interneuron; an NMR-2::GFP fusion protein is expressed in the AVA, AVD, AVE, RIM, AVG, and PVC interneurons beginning at the three-fold stage of embryogenesis; NMR-2::GFP expression is coincident with that of NMR-1, a second C. elegans NMDA-type ionotropic glutamate receptor subunit also required for memory retention; nmr-2 expression in AVA and AVE is positively regulated by the FAX-1 nuclear receptor.

Links

External Databases