UTRome

unc-108

F53F10.4 | UNCoordinated 108

unc-108 encodes a small GTPase homologous to the Rab GTPases that function in endocytosis, membrane fusion, and vesicular trafficking events; unc-108 function is required in neurons for normal locomotion; unc-108 also functions in the removal of apoptotic cells, specifically it functions in engulfing cells for the recruitment and fusion of the lysosome to the phagosome; unc-108 is expressed in neurons and in engulfing cells.

Graphics for unc-108

3'UTR Zoom
Locus

see this gene in GBrowse
Legend: Blue:ORF, Gray:Updated 3'UTRome V3 dataset.


Operon Information

This gene is part of the operon CEOP1116 (I:3828133..3824949)
CEOP1116 contains 2 genes in the following order:
Blumenthal et al., Nature 417, 851-854
Click the picture below to launch Gbrowse

3'UTR mapped for unc-108

If available, we display here the 3'UTRs sequences we obtained by our analysis (in FASTA format). Putative canonical PAS sites, if found, are highlighted in yellow.

1 ID: 5759 - Tier: 1 - Name: unc-108 - Cosmid: F53F10.4 - WBGeneID: WBGene00006833 - Length: 482 - PAS: aatgaa
Cluster Coverage (%): 31019 reads (100.00%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

id Name Chr Strand Start End Length PAS Coverage
5759 unc-108 I + 3826043 3826524 482nt aatgaa (-26nt) 31019 reads

This 3'UTR isoform has been detected in the following tissues:
UTRome v31 Intestine2 Pharynx2 Body Muscle2 Arcade cells2 GABA neurons2 NMDA neurons2 Hypodermis2 Seam cells2
 
1Murari et al., 2023
2Blazie et al., 2016 - Alternative polyadenylation directs tissue specific miRNA targeting in Caenorhabditis elegans somatic tissues. - under review (mixed stages & tissue-specific datasets)
 
>|3'UTR|482nt|I:3826043..3826524|PAS:aatgaa
uuuuugaugauguuucuuugaaugagcuuugaauguuuuaacuaaaucguuugaauaccaaucuuuuuuauguuuccucc
ucuuuucgaaugucguuaggcacuuuucuagucuccuuucucucuuccagaaccauaauuuuacuuuacauauauauugc
aauugucucuuauuacuaccaucauuuacuguauauugucgccugcuuuuucucuuucuccucucuuucucuauuuucuc
uccuuuucauucagucucucaccaauugugugaauaucugaaauuccugugauuuuccacucaauccaucagaacaacau
guugugaaaaucccgcucucucucccucauuuccucuuaaaaguuuguauguaagcucuacuucuuuuuuccuuuucuaa
uucuuuccauuuaauuacuauacgucuccaagcuaucaaaauuuucagugaaauaaaugaauuuuaugagcguuucgucg
a


Updated miRanda Targets for unc-108 (Murari et al., submitted)

unc-108 transcript has been predicted to be targeted by the following miRNAs:

ID miRNA Target Gene Score Energy % Binding (Target) % Binding (miRNA)
52212 cel-miR-265 unc-108 165 -30.64 75.00 93.75
8032 cel-miR-46-5p unc-108 160 -14.41 73.68 73.68
8391 cel-miR-47-5p unc-108 160 -14.42 73.68 73.68
44501 cel-miR-249-3p unc-108 160 -17.10 63.16 84.21
69117 cel-miR-797-5p unc-108 158 -11.60 73.68 78.95
2443 cel-miR-2-3p unc-108 157 -13.57 65.00 75.00
138056 cel-miR-8192-3p unc-108 155 -12.99 66.67 77.78
96513 cel-miR-4805-3p unc-108 155 -6.54 78.57 85.71
14466 cel-miR-61-3p unc-108 155 -11.66 72.22 72.22
125953 cel-miR-5549-3p unc-108 154 -16.12 70.00 75.00
35564 cel-miR-234-5p unc-108 154 -11.10 72.73 72.73
146579 cel-miR-8206-3p unc-108 153 -13.29 72.22 77.78
123328 cel-miR-5547-5p unc-108 152 -9.38 76.19 76.19
129830 cel-miR-5551-5p unc-108 152 -12.98 73.33 80.00
133365 cel-miR-356b-5p unc-108 149 -15.92 60.00 70.00
16517 cel-miR-67-5p unc-108 149 -12.16 50.00 80.00
46206 cel-miR-253-5p unc-108 148 -7.76 84.62 84.62
41699 cel-miR-247-5p unc-108 148 -8.45 73.33 73.33
80453 cel-miR-1828 unc-108 147 -14.58 65.00 70.00
109475 cel-miR-4925 unc-108 147 -8.17 90.00 90.00
41700 cel-miR-247-5p unc-108 146 -9.10 88.89 100.00
7688 cel-miR-45-3p unc-108 146 -11.47 88.89 100.00
71611 cel-miR-800-5p unc-108 146 -7.08 63.16 73.68
7092 cel-miR-44-3p unc-108 146 -11.47 88.89 100.00
151313 cel-miR-2217b-1-5p unc-108 145 -18.66 100.00 100.00
138057 cel-miR-8192-3p unc-108 145 -11.10 100.00 100.00
107450 cel-miR-4923a unc-108 145 -10.16 100.00 100.00
41701 cel-miR-247-5p unc-108 145 -7.91 100.00 100.00
40643 cel-miR-246-5p unc-108 143 -11.21 64.29 78.57
150966 cel-miR-8210-3p unc-108 143 -13.82 61.11 66.67
57439 cel-miR-358-3p unc-108 142 -11.05 88.89 88.89
107451 cel-miR-4923a unc-108 141 -9.16 87.50 100.00
43794 cel-miR-247-3p unc-108 141 -14.06 87.50 100.00
41702 cel-miR-247-5p unc-108 141 -9.54 90.00 90.00
139593 cel-miR-8196a-3p unc-108 141 -8.24 71.43 78.57
45016 cel-miR-250-3p unc-108 140 -10.05 100.00 100.00
6257 cel-miR-43-3p unc-108 140 -9.18 100.00 100.00



Predicted or Experimental Interactors for unc-108 (WormBase)

unc-108 has been predicted to interact with the following genes (data from WS200):

  • cct-4 Lee I et al. (2008)
  • gdi-1 Lee I et al. (2008)
    gdi-1 encodes a member of the Rab GDP dissociation inhibitor (GDI) family with high similarity to Drosophila Gdi; expressed around the pharyngeal, vulval, and tail regions.
  • nhr-49 Lee I et al. (2008)
    none available
  • rab-6.2 Lee I et al. (2008)
    rab-6.2 encodes a small, monomeric Rab GTPase that is most closely related to the Drosophila and mammalian Rab6 GTPases; by homology, RAB-6.2 is predicted to function in the regulation of intracellular membrane trafficking; RNAi experiments indicate that rab-6.2 is required redundantly with rab-6.1 for normal embryonic development and reproduction.
  • tag-210 Lee I et al. (2008)
    none available


 

© The Biodesign Institute at Arizona State University - PO Box 875001, Tempe, AZ 85287-5001