coq-4

Operon Information

3'UTR mapped for coq-4

1 ID: 762 - Tier: 1 - Name: coq-4 - Cosmid: T03F1.2 - WBGeneID: WBGene00000764 - Length: 48 - PAS: aatgaa
Cluster Coverage (%): 357 reads (38.30%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

UTRome v31	Intestine2	Pharynx2	Body Muscle2	Arcade cells2	GABA neurons2	NMDA neurons2	Hypodermis2	Seam cells2

>|3'UTR|48nt|I:3870064..3870111|PAS:aatgaa
uauagauuugaucuugaauuucucagugauaaugaaaaaaugaauua

2 ID: 763 - Tier: 1 - Name: coq-4 - Cosmid: T03F1.2 - WBGeneID: WBGene00000764 - Length: 63 - PAS: aattaa
Cluster Coverage (%): 575 reads (61.70%)
(See this 3'UTR in GBrowse!) (See this Gene in GBrowse!)

UTRome v31	Intestine2	Pharynx2	Body Muscle2	Arcade cells2	GABA neurons2	NMDA neurons2	Hypodermis2	Seam cells2

>|3'UTR|63nt|I:3870064..3870126|PAS:aattaa
uauagauuugaucuugaauuucucagugauaaugaaaaaaugaauuaauuaauuuuuuugga

Updated miRanda Targets for coq-4 (Murari et al., submitted)

Predicted or Experimental Interactors for coq-4 (WormBase)

• alh-4 Lee I et al. (2008)
  none available
• clk-1 Lee I et al. (2008)
  clk-1 encodes the C. elegans ortholog of COQ7/CAT5, a highly conserved demethoxyubiquinone (DMQ) hydroxylase that is necessary for the biosynthesis of ubiquinone (coenzyme Q, Q9) from 5-demethoxyubiquinone (DMQ9); in C. elegans, CLK-1 activity is required for normal physiological rates of growth, development, behavior, and aging, as well as for normal brood sizes.
• coq-3 Lee I et al. (2008)
  coq-3 encodes a putative 3,4-dihydroxy-5-hexaprenylbenzoate methyltransferase, orthologous to S. cerevisiae COQ3; by orthology, COQ-3 is predicted to be in a complex with COQ-4 (and perhaps COQ-6), and to be required for two different steps of ubiquinone synthesis; COQ-3 is required for viability, ubiquinone (coenzyme Q9) biosynthesis and for normally short lifespan; coq-3 null mutations are lethal; coq-3(RNAi) animals have reduced levels of coenzyme Q9 and superoxide, and have abnormally long lifespans.
• coq-5 Lee I et al. (2008)
  coq-5 encodes a putative 2-hexaprenyl-6-methoxy-1,4-benzoquinone methyltransferase, homologous to COQ5 in S. cerevisiae and to a family of methyltransferases involved in ubiquinone, menaquinone, biotin and sterol biosynthesis and in phosphatidylethanolamine methylation; COQ-5 is required for ubiquinone (coenzyme Q9) biosynthesis and for normally short lifespan; coq-5 can transgenically rescue a coq-5 deletion in S. cerevisiae; coq-5(RNAi) animals have reduced levels of coenzyme Q9 and superoxide, and have abnormally long lifespans.
• dcs-1 Lee I et al. (2008)
  dcs-1 encodes a scavenger mRNA decapping enzyme; dcs-1 exhibits hydrolase activity in vitro, with specificity for 7meGMP in its primary nucleoside monophosphate binding site; dcs-1 is the upstream gene in an operon with fre-1, which encodes an NADPH-dependent flavin reductase; reporter fusions using dcs-1 upstream sequence direct expression throughout the life cycle in neurons and pharyngeal muscle; expression is present in dauer larvae and enhanced by heat shock.
• kin-1 Lee I et al. (2008)
  kin-1 encodes multiple isoforms of a serine/threonine protein kinase that is orthologous to cAMP-dependent protein kinase (protein kinase A or PKA) catalytic subunits; KIN-1 is able to phosphorylate histone H2B in vitro and is associated with both particulate (~65%) and cytosolic (35%) cellular fractions; KIN-1 is expressed at low levels during embryogenesis, but its expression level increases in late embryogenesis, whereupon KIN-1 expression remains relatively high throughout larval and adult development; kin-1 mRNA levels, however, are fairly constant throughout development, suggesting that KIN-1 expression is regulated post-transcriptionally; as loss of kin-1 activity via large-scale RNAi screens results in no obvious defects, the precise role of kin-1 in C. elegans development and/or behavior is not yet known.
• pas-3 Lee I et al. (2008)
  pas-3 encodes that affects embryonic viability, growth, fertility, and locomotion.
• pas-7 Lee I et al. (2008)
  pas-7 encodes a proteasome alpha-type three subunit of the core 20S proteasome subcomplex; loss of pas-7 activity via RNAi results in several defects including embryonic and larval lethality, sterility, and abnormal meiotic progression.
• pnc-1 Lee I et al. (2008)
  pnc-1 encodes, by alternative splicing, two isoforms of a putative pyrazinamidase/nicotinamidase, orthologous to budding yeast Pnc1p, that is required for normal lifespan; PNC-1 is paralogous to Y57G11C.47; because its overexpression increases survival during oxidative stress, PNC-1 may be required for oxidative resistance in vivo; pnc-1(RNAi) animals are abnormally short-lived.
• prdx-6 Lee I et al. (2008)
  none available

Links

External Databases